Secernin-3
WebMarimuthu A, Chavan S, Sathe G, Sahasrabuddhe NA, Srikanth et al. Identification of secernin 1 as a novel immunotherapy target SM, Renuse S, et al. Identification of head and neck squamous cell for gastric cancer using the expression profiles of cDNA microar- carcinoma biomarker candidates through proteomic analysis of can- ray. Web27 Jan 2024 · It is demonstrated that SCRN1 is upregulated in OSCC and promotes proliferation, invasion and metastasis of OSCC cells via TGF-β/Smad3 signaling. Background Secernin-1 (SCRN1) is a regulator of exocytosis in mast cells. Recently, SCRN1 has been reported to be correlated with the prognosis of colorectal cancer and gastric cancer but …
Secernin-3
Did you know?
Web3 Feb 2024 · SCRN3 protein is ubiquitously expressed in the brain, yet gene expression is regulated by inflammatory stimuli. In an inflammatory pain mouse model, behavioral … WebSecernin 1 is a novel 50-kDa cytosolic protein that appears to be involved in the regulation of exocytosis from peritoneal mast cells. Secernin-1 a novel tumor-associated antigen (TAA) and may be a universal marker of different cancer types including gastric cancer, which has been validated by several researches.
WebZistiť viac o Anti-SCRN3 Rabbit polyclonal antibody. Umožňujeme pokrok vo vede ponukou výberu produktov, služieb, excelentnosti procesov a našich ľudí, ktorí ich zabezpečujú. WebTable S1. Quantitative RT-PCR Primer and siRNA Sequences Gene Name Gene RefSeq or GenBank Forward Primer Reverse Primer siRNA Name siRNA Sequence (plus) siRNA Sequence Symbol Accession (minus/guide) a disintegrin and metalloproteinase domain 9 ADAM9 NM_003816 ACCTCAGCAGTTCCCATCAA TAAAGGAGGTGCAGGAGCAG …
Web欢迎您访问武汉艾美捷科技有限公司官方网站! Web11 Feb 2024 · Another study demonstrated that Myosin Va can act as a sensor of ER-derived calcium to drive the release of membrane vesicles, which it normally tethers to two major ER channels—the ryanodine receptor type 3 (RyR3) and the 1,4,5-triphosphate (IP3) receptor (IP3R) . This process was shown to be instrumental for attractive growth cone turning and …
WebSecernin Entry whose protein (s) existence is based on evidence at protein level. Show evidences Annotations in this section apply to all the isoforms if not specified otherwise. OVERVIEW Regulates exocytosis in mast cells. Increases both the extent of secretion and the sensitivity of mast cells to stimulation with calcium (By similarity). • gold 1
Web3. Yang X, Tohda C. Diosgenin restores memory function via SPARC-driven axonal growth from the hippocampus to the PFC in Alzheimer’s disease model mice. Molecular Psychiatry, in press 4. Yang X, Tohda C. Axonal regeneration mediated by a novel axonal guidance pair, Galectin-1 and Secernin-1. Mol Neurobiol 60:1250-1266, 2024 5. palm church virginia beachWebAntibody id ENSG Gene Gene desc WellPlate well plate compartment variance_comp gini_comp isKnownCCD CCD_COMP nonccd_comp HPA012567 ENSG00000003137 CYP26B1 cytochrome P450 family 2 sunday night television showsWebScrn3 MGI Mouse Gene Detail - MGI:1921866 - secernin 3. GO Browser. Download. All MGI Reports. Genes & Markers. Vertebrate Homology. Gene Ontology Data. sunday notary near meWebEnter the email address you signed up with and we'll email you a reset link. sunday night with trey gowdyWebSecernin-3. Gene. Scrn3. Source organism. Mus musculus (Mouse) go to search. UniProt. Q3TMH2 go to UniProt. Experimental structures. None available in the PDB. Biological … palm church glasgowWebIn other projects. SCRN1 - SCRN1 SCRN1; Identificadores; Apelido: SCRN1, SES1, secernin 1: IDs externos: OMIM: 614965 MGI: 1917188 HomoloGene: 8853 GeneCards: SCRN1 palm chsir cushionWebPROTEIN EXPRESSIONi. Antibody staining in 20 different cancers is summarized by a selection of four standard cancer tissue samples representative of the overall staining pattern. From left: colorectal cancer, breast cancer, prostate cancer and lung cancer. An additional fifth image can be added as a complement. sunday notes steve simmons